| Primary Identifier | MGI:6302803 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Hars2 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGTGAATTCAGTAAAGCCCG and TATCATGGCTCTAAAAACCC, which resulted in a 225 bp deletion beginning at Chromosome 18 position 36,788,466 bp and ending after 36,788,690 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001240057 (exon 8) and 131 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 243 and early truncation 24 amino acids later. There is a 4 bp insertion at the deletion site (CTAC). |
