| Primary Identifier | MGI:6331113 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Ist1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTATCTTGTACACAAGCTTC and AGGGGAGTAGATGTGCTAAG, which resulted in a 978 bp deletion beginning at Chromosome 8 position 109,681,965 bp and ending after 109,682,942 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000212413 and ENSMUSE00000212415 (exons 3 and 4) and 709 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 29and early truncation 26 amino acids later. There is a 7 bp intronic deletion 96 bp before the larger deletion. |
