| Primary Identifier | MGI:6303599 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Ppox |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CGAGCTGCTGGACGGACGAG and AGTGAAGCACTGTCGCCACA, which resulted in a 3290 bp deletion beginning at Chromosome 1 position 171,277,260 bp and ending after 171,280,549 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001209397 - ENSMUSE00001248877 (exons 3-12) and 2086 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 29 and early truncation 6 amino acids later. |
