| Primary Identifier | MGI:6314199 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Pfas |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CATTGTGGTAGGAGATCAAG and CTATCGACCCAACACACCAC, which resulted in a 431 bp deletion beginning at Chromosome 11 position 69,001,500 bp and ending after 69,001,930 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001257651 (exon 4) and 325 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 92 and early truncation 21 amino acids later. |