|  Help  |  About  |  Contact Us

Allele : Dnajb14<em1(IMPC)J> DnaJ heat shock protein family (Hsp40) member B14; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6314206 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Dnajb14
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCTTCTGGAGAGACTAAACA and ATATAGCACAGTTTAATAGA, which resulted in a 396 bp deletion beginning at Chromosome 3 position 137,885,162 bp and ending after 137,885,557 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001225953 (exon 2) and 224 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause an early truncation after amino acids 45. There is an 8 bp insertion (TTCATAGC) at the deletion site and a single bp insertion (T) 11 bp before the deletion site.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

4 Publication categories