| Primary Identifier | MGI:6314147 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Atp13a3 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTTGCTCCTTTACTTCACAT and TATAGTCATGGAATAAGACT, which resulted in a 423 bp deletion beginning at Chromosome 16 position 30,356,957 bp and ending after 30,357,379 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000393476 (exon 8) and 353 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 183 and early truncation 25 amino acids later. |
