| Primary Identifier | MGI:6314220 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Fam193a |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCTAGGTGCACAAATCCCAT and TTATGTTCACCTCAGCAGCC, which resulted in a 383 bp deletion beginning at Chromosome 5 position 34,426,149 bp and ending after 34,426,531 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001144988 (exon 5) and 148 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 263 and early truncation 4 amino acids later. |