| Primary Identifier | MGI:6336114 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Col6a3 |
| Strain of Origin | C57BL/6NTac | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from IMPC was generated at Korea Mouse Phenotype Consortium by injecting CAS9 RNA and 4 guide sequences AAGTCAGGTGCTAACAACCCTGG, CCCCAATCCAAGCAACCGACCCA, CAAAATGAGATCTCCCACGTGGG, CCACTGTGATGAACACTAATCAC, which resulted in a Exon Deletion. |
