| Primary Identifier | MGI:6305226 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Wfdc17 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATAAGTGACTTCTCTCTAAT and CTAGAAGATCACTAGGACCA, which resulted in a 492 bp deletion beginning at Chromosome 11 position 83,703,768 bp and ending after 83,704,259 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000578061 (exon 1) and 309 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a null allele. |