|  Help  |  About  |  Contact Us

Allele : Wfdc17<em1(IMPC)J> WAP four-disulfide core domain 17; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6305226 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Wfdc17
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATAAGTGACTTCTCTCTAAT and CTAGAAGATCACTAGGACCA, which resulted in a 492 bp deletion beginning at Chromosome 11 position 83,703,768 bp and ending after 83,704,259 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000578061 (exon 1) and 309 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a null allele.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

3 Publication categories