| Primary Identifier | MGI:6304264 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Lurap1l |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CCGTATGTCACAGACAAGAA and GGCTAGTGCGGGAGAATCCG, which resulted in a 1322 bp deletion beginning at Chromosome 4 position 80,910,589 bp and ending after 80,911,910 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000405695 (exon 1) and 322 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a null allele. |
