| Primary Identifier | MGI:6304268 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Trappc11 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTGCATGGTGAAGTTCAGCT and AGGGCTCCTGTTCTTCCTGA, which resulted in a 342 bp deletion beginning at Chromosome 8 position 47,526,831 bp and ending after 47,527,172 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001221466 (exon 3) and 172 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 68 and early truncation 40 amino acids later. |
