| Primary Identifier | MGI:6304302 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified isoform(s) | Gene | Retreg1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CCTTTGTGATACGTACTCAA and TGGATGGCAGGGCAGTGGCG, which resulted in a 268 bp deletion beginning at Chromosome 15 position 25,894,926 bp and ending after 25,895,193 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000649912 (exon 2) and 161 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 90 and early truncation 8 amino acids later. There is a 5 bp (GTATA) insertion at the deletion site. |
