| Primary Identifier | MGI:6336204 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Cln8 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NCrl |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from IMPC was generated at UC Davies by injecting CAS9 Protein, 2 guide sequences CGGCCAAAGAGAAGGTCTTCTGG, GGCGTCCAGAGCACAACTGCAGG, and a non-contributing oligo, which resulted in an Intra-exon deletion. |
