| Primary Identifier | MGI:6314807 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Pla2g2a |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCTCCGTGTCCGTTTTCCCC and GCGTGTGTGTTCTCATAACT, which resulted in a 471 bp deletion beginning at Chromosome 4 position 138,834,740 bp and ending after 138,835,210 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000402801 (exon 6) and 37 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 98 and truncation 68 amino acids later by read through after exon 5. |
