|  Help  |  About  |  Contact Us

Allele : Dnai4<em1(IMPC)J> dynein axonemal intermediate chain 4; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6314811 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Dnai4
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCTGGACGCATGAATCCAAA and TGTATTAGTAGTAAATACAG, which resulted in a 450 bp deletion beginning at Chromosome 4 position 103,096,547 bp and ending after 103,096,996 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001222873 (exon 3) and 265 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 76 and early truncation 15 amino acids later. There is a single bp (T) insertion 73 bp before the deletion.
  • mutations:
  • Insertion,
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

4 Publication categories