| Primary Identifier | MGI:6314811 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Dnai4 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCTGGACGCATGAATCCAAA and TGTATTAGTAGTAAATACAG, which resulted in a 450 bp deletion beginning at Chromosome 4 position 103,096,547 bp and ending after 103,096,996 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001222873 (exon 3) and 265 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 76 and early truncation 15 amino acids later. There is a single bp (T) insertion 73 bp before the deletion. |