| Primary Identifier | MGI:6305162 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified isoform(s) | Gene | Znfx1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTGTGGAGCCTGCTAGAAAG and CTATCTCAACTGGTGCCTCA, which resulted in a 268 bp deletion beginning at Chromosome 2 position 167,048,375 bp and ending after 167,048,642 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000511240 (exon 5) and 119 bp of flanking intronic sequence including the splice acceptor and donor. |
