|  Help  |  About  |  Contact Us

Allele : Znfx1<em1(IMPC)J> zinc finger, NFX1-type containing 1; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6305162 Allele Type  Endonuclease-mediated
Attribute String  Modified isoform(s) Gene  Znfx1
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTGTGGAGCCTGCTAGAAAG and CTATCTCAACTGGTGCCTCA, which resulted in a 268 bp deletion beginning at Chromosome 2 position 167,048,375 bp and ending after 167,048,642 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000511240 (exon 5) and 119 bp of flanking intronic sequence including the splice acceptor and donor.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

4 Publication categories