| Primary Identifier | MGI:6341948 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Teddm1a |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from project TCPR1305 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of ATTGAGCTATGAGTCTAACA, GTCATTGAATATCACAGCTC, and GTGACCGGGCCTAGAATACC targeting a critical region. This resulted in a 418-bp del Chr1:153891772-153892189_insGGA, 14-bp del Chr1:153892701-153892714 (GRCm38). |
