|  Help  |  About  |  Contact Us

Allele : Teddm1a<em1(IMPC)Tcp> transmembrane epididymal protein 1A; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:6341948 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Teddm1a
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from project TCPR1305 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of ATTGAGCTATGAGTCTAACA, GTCATTGAATATCACAGCTC, and GTGACCGGGCCTAGAATACC targeting a critical region. This resulted in a 418-bp del Chr1:153891772-153892189_insGGA, 14-bp del Chr1:153892701-153892714 (GRCm38).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

Trail: Allele

0 Driven By

5 Publication categories

Trail: Allele