|  Help  |  About  |  Contact Us

Allele : Ik<em2(IMPC)Kmpc> IK cytokine; endonuclease-mediated mutation 2, Korea Mouse Phenotyping Center

Primary Identifier  MGI:6341961 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Ik
Strain of Origin  C57BL/6NTac Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from IMPC was generated at Korea Mouse Phenotype Consortium by injecting CAS9 Protein and 2 guide sequences ACCGGGACCGTGCCAAGGAACGG, CCCCACTGCTGAGGCGTGAGTAA, which resulted in a Indel.
  • mutations:
  • Insertion,
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

4 Publication categories