|  Help  |  About  |  Contact Us

Allele : Crx<em1(IMPC)Ccpcz> cone-rod homeobox; endonuclease-mediated mutation 1, Institute of Molecular Genetics

Primary Identifier  MGI:6341903 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Crx
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NCrl
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from IMPC was generated at Czech centre for Phenogenomics by injecting CAS9 Protein and 2 guide sequences CCTACAAGAATTTGCCCTTCCAT, GAGTGACATATGGAACGTGAGGG, which resulted in a Exon Deletion.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

4 Publication categories