|  Help  |  About  |  Contact Us

Allele : Ap2s1<em2(IMPC)Tcp> adaptor-related protein complex 2, sigma 1 subunit; endonuclease-mediated mutation 2, The Centre for Phenogenomics

Primary Identifier  MGI:6316162 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Ap2s1
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from project TCPR0357 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and two guide RNAs with spacer sequence of GCAAGACGCGCCTGGCCAAG targeting the 5' side and GATCGAGGAGGTGCACGCCG targeting the 3' side of exon ENSMUSE00000286435. This mutation is predicted to cause a frameshift with the amino acid changes after residue 20 and early truncation 46 amino acids later (p.Y20S*fs48).
  • mutations:
  • Insertion,
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

3 Publication categories