|  Help  |  About  |  Contact Us

Allele : Aspg<em2(IMPC)Tcp> asparaginase; endonuclease-mediated mutation 2, The Centre for Phenogenomics

Primary Identifier  MGI:6316163 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Aspg
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from project TCPR0619 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of TAGGCGGGACTGTGGCACCC and CGATCTCCAACTAGGATGTG targeting the 5' side and GCCCAAACCATAGAGGTAGA and CTGGGCAAGTGAGTAACTAT targeting the 3' side of exon ENSMUSE00000396327 resulting in a 393-bp deletion of Chr12 from 112112431 to 112112823 and a 468-bp deletion of Chr12 from 112112828 to 112113295_insA (GRCm38).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

3 Publication categories