| Primary Identifier | MGI:6316169 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Cdyl2 |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from project TCPR1032 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNA(s) with spacer sequences of TCCGGGAGGATGACGAGTCC targeting the 5' side and TGGTGAGTTAGCAACACGCC targeting the 3' side of a critical exon. This resulted in a 596-bp del Chr8: 116594751 to 116595346 (GRCm38) resulting in a frameshift mutation in all annotated full length protein-coding transcripts. |
