| Primary Identifier | MGI:6316314 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Plcg2 |
| Strain of Origin | B6(SJL)-Apoe<tm1.1(APOE*4)Adiuj>/J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | A C-to-G mutation was engineered in proline codon 522 (CCC) to change it to an arginine codon (CGC) (c.1565C>G, p.P522R) with an sgRNA (targeting CCAAAATGCAGCTCCGTGGG) and an ssODN template (GAGCTGTAATAAGCCCTTTCGGATGCTTGTGGCTCAGGACACTCGCCCCACGGAGCTGCATTTTGGGGAGAAATGGTTCCACA) using CRISPR/Cas9 technology. The mutation models a human SNP that was identified in a whole exome chip of rare SNPs associated with Alzheimer's disease and has been associated with protection from Alzheimer's disease. |
