|  Help  |  About  |  Contact Us

Allele : Gpr141b<em2(IMPC)Tcp> G protein-coupled receptor 141B; endonuclease-mediated mutation 2, The Centre for Phenogenomics

Primary Identifier  MGI:6316184 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Gpr141b
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from project TCPR0383 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and three guide RNAs with spacer sequences of CACTTGAGCCATTTGACACG, GTTACAAAAGTTCCATGCCG and TTATACCCCACCATGCATTC resulting in a 744 bp deletion of Chr13 from 19729111 to 19729854 (GRCm38). This mutation is predicted to cause a frameshift with the amino acid changes after residue 10 and early truncation 39 amino acids later (p.S10Vfs*41).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories