| Primary Identifier | MGI:6316184 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Gpr141b |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from project TCPR0383 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and three guide RNAs with spacer sequences of CACTTGAGCCATTTGACACG, GTTACAAAAGTTCCATGCCG and TTATACCCCACCATGCATTC resulting in a 744 bp deletion of Chr13 from 19729111 to 19729854 (GRCm38). This mutation is predicted to cause a frameshift with the amino acid changes after residue 10 and early truncation 39 amino acids later (p.S10Vfs*41). |
