|  Help  |  About  |  Contact Us

Allele : Hdgfl3<em2(IMPC)Tcp> HDGF like 3; endonuclease-mediated mutation 2, The Centre for Phenogenomics

Primary Identifier  MGI:6316187 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Hdgfl3
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from project TCPR0726 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of AGCGTGTAAGCCACCAACTC and ATGATATGTGCTTATCCCAC targeting the 5' side and CTGTGATGCAAACTATTACC and GATTCAATTAATGACTCAAG targeting the 3' side of exon ENSMUSE00001263741 resulting in a 353-bp deletion of Chr7 from 81900282 to 81900634 (GRCm38).
  • mutations:
  • Intragenic deletion,
  • Insertion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories