|  Help  |  About  |  Contact Us

Allele : Hgsnat<em7(IMPC)Tcp> heparan-alpha-glucosaminide N-acetyltransferase; endonuclease-mediated mutation 7, The Centre for Phenogenomics

Primary Identifier  MGI:6316188 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Hgsnat
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from project TCPR0251 was generated at The Centre for Phenogenomics by injecting Cas9 endonuclease and a guide RNA with the spacer sequence GCAGGTTAACTCCACCTCGG resulting in a 17-bp deletion from Chr8:25971594 to 25971578 (GRCm38).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories