|  Help  |  About  |  Contact Us

Allele : Hook1<em2(IMPC)Tcp> hook microtubule tethering protein 1; endonuclease-mediated mutation 2, The Centre for Phenogenomics

Primary Identifier  MGI:6316189 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Hook1
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from project TCPR858 was generated at The Centre for Phenogenomics by injecting Cas9 ribonucleoprotein complexes and single guide RNA(s) with spacer sequences of ATGTTCTCCGGACAAAAATG and GTTCCATCAGCGACATAGGC targeting the 5' side and ACATTGCTAGTTCTCGATGC and GCCACTGACCTCCAGAATAT targeting the 3' side leading to a 1597-bp deletion from Chr4:95991796 to 95993392; 10-bp deletion Chr4: 95991707 to 95991716 (GRCm38) resulting in a frameshift mutation in all annotated full length protein-coding transcripts.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories