|  Help  |  About  |  Contact Us

Allele : Jade2<em2(IMPC)Tcp> jade family PHD finger 2; endonuclease-mediated mutation 2, The Centre for Phenogenomics

Primary Identifier  MGI:6316193 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Jade2
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from project TCPR858 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes and single guide RNAs with spacer sequences of AGGACGGCTTCGTAGGCCAG and CCGGAAAACCTGCAGACATG targeting the 5' side and CTAGGAACGAATCTCAGAAC and GTTACTTACCCATGAGGCTT targeting the 3' side leading to a 1-bp deletion Chr11:51835394_delG, 271-bp deletion Chr11:51835470 to 51835740, and a 7-bp deletion Chr11:51835782 to 51835788 (GRCm38) resulting in a frameshift mutation in all annotated full length protein-coding transcripts (GRCm38).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories