|  Help  |  About  |  Contact Us

Allele : Nans<em1(IMPC)Tcp> N-acetylneuraminic acid synthase (sialic acid synthase); endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:6316200 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Nans
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from project TCPR1155 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs with spacer sequences of TTCTTGTAGCAACTGATGGC and GAGGGAATACCTTTCACTAT targeting the 5' side and TAGTGTCGTGTGGAGACGTT and ATGGAAGCAGGTCGTATTAC targeting the 3' side of a critical exon. This resulted in a 673-bp del Chr4:46498890 to 46499562 with an insertion of 152-bp resulting in a frameshift mutation in all annotated full length protein-coding transcripts. (GRCm38)
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

4 Publication categories