|  Help  |  About  |  Contact Us

Allele : Nav2<em2(IMPC)Tcp> neuron navigator 2; endonuclease-mediated mutation 2, The Centre for Phenogenomics

Primary Identifier  MGI:6316201 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Nav2
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from project TCPR0782 was generated at The Centre for Phenogenomics by electroporating Cas9 RNPs with four guide RNAs with spacer sequences of CGGCCCTCCCTTGTCTAAAA and CGTCACCAGAGGCATAAATG targeting the 5' side and GGCGCTGCCGACCCATCTTC and CCAATCAGACCAGTGGCGCT targeting the 3' side of exon ENSMUSE00001316074 resulting in a 676-bp deletion of Chr7 from 49408593 to 49409268_insT; 1-bp insertion Chr7:49408480_insA (GCRm38).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories