| Primary Identifier | MGI:6316201 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Nav2 |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from project TCPR0782 was generated at The Centre for Phenogenomics by electroporating Cas9 RNPs with four guide RNAs with spacer sequences of CGGCCCTCCCTTGTCTAAAA and CGTCACCAGAGGCATAAATG targeting the 5' side and GGCGCTGCCGACCCATCTTC and CCAATCAGACCAGTGGCGCT targeting the 3' side of exon ENSMUSE00001316074 resulting in a 676-bp deletion of Chr7 from 49408593 to 49409268_insT; 1-bp insertion Chr7:49408480_insA (GCRm38). |
