|  Help  |  About  |  Contact Us

Allele : Qki<em1Tcp> quaking, KH domain containing RNA binding; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:6316207 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Qki
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false
molecularNote  This allele from project TCPR0523 was generated at The Centre for Phenogenomics by injecting Cas9 ribnucleoprotein complex with synthetic crRNAs with a spacer sequences of UGCCUCAGCAAGAUUUAAAC targeting the 5' side and GGUUCAAGCUAUGGAUUCUG targeting the 3' side of exon ENSMUSE00000269846 resulting in a 847-bp deletion of Chr17 from 10282533 to 10283379 (GRCm38).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories

Trail: Allele