| Primary Identifier | MGI:6316207 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Qki |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | This allele from project TCPR0523 was generated at The Centre for Phenogenomics by injecting Cas9 ribnucleoprotein complex with synthetic crRNAs with a spacer sequences of UGCCUCAGCAAGAUUUAAAC targeting the 5' side and GGUUCAAGCUAUGGAUUCUG targeting the 3' side of exon ENSMUSE00000269846 resulting in a 847-bp deletion of Chr17 from 10282533 to 10283379 (GRCm38). |
