| Primary Identifier | MGI:6316213 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Serpinb3d |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from project TCPR0441 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNA with spacer sequences of TTGTGTAAGGTTGTCACTGA and ATCATGCAGATTTTTCACTC targeting the 5' side and CCTGTAGTATTTCCACTGAT and TATAGCCTATCTAGTGGTGT targeting the 3' side of exon ENSMUSE00001035727 (exon 4) resulting in a 409-bp deletion of Chr1 from 107080521 to 107080929 (GRCm38). |
