|  Help  |  About  |  Contact Us

Allele : Serpinb3d<em2(IMPC)Tcp> serine (or cysteine) peptidase inhibitor, clade B (ovalbumin), member 3D; endonuclease-mediated mutation 2, The Centre for Phenogenomics

Primary Identifier  MGI:6316213 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Serpinb3d
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from project TCPR0441 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNA with spacer sequences of TTGTGTAAGGTTGTCACTGA and ATCATGCAGATTTTTCACTC targeting the 5' side and CCTGTAGTATTTCCACTGAT and TATAGCCTATCTAGTGGTGT targeting the 3' side of exon ENSMUSE00001035727 (exon 4) resulting in a 409-bp deletion of Chr1 from 107080521 to 107080929 (GRCm38).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories

Trail: Allele