|  Help  |  About  |  Contact Us

Allele : Slc23a3<em2(IMPC)Tcp> solute carrier family 23 (nucleobase transporters), member 3; endonuclease-mediated mutation 2, The Centre for Phenogenomics

Primary Identifier  MGI:6316215 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Slc23a3
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from project TCPR0441 was generated at The Centre for Phenogenomics by injecting Cas9 nickase (D10A) mRNA and four guide RNA with spacer sequences of CAGCGAGACTGAATAAATTA and GTCACGTGGTATGATACCTC targeting the 5' side and GGACTGTCGGGAGTAATCAA and GTTTAGATTATCAGGCCCTG targeting the 3' side of the critical exon resulting in an indel at Chr1:75132438-75132440_delTATinsACGTG and a 1076-bp deletion on Chr1 from 75131273 to 75132348 (GRCm38).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories