| Primary Identifier | MGI:6316215 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Slc23a3 |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from project TCPR0441 was generated at The Centre for Phenogenomics by injecting Cas9 nickase (D10A) mRNA and four guide RNA with spacer sequences of CAGCGAGACTGAATAAATTA and GTCACGTGGTATGATACCTC targeting the 5' side and GGACTGTCGGGAGTAATCAA and GTTTAGATTATCAGGCCCTG targeting the 3' side of the critical exon resulting in an indel at Chr1:75132438-75132440_delTATinsACGTG and a 1076-bp deletion on Chr1 from 75131273 to 75132348 (GRCm38). |