| Primary Identifier | MGI:6316222 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Tmem121b |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from project TCPR0755 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with four guide RNAs having spacer sequences of GAGAGCGGCCGGGCAGCCCC and CGGGTGCATTGTCCTCGGAG targeting the 5' side and AGGAGCACCATAGCTGCTTC and CATTTTCCAAGTGGCCCCGC targeting the 3' side of exon ENSMUSE00001064169 resulting in a 1,669-bp deletion of Chr6 from 120492106 to 120493777_insTCT. (GRCm38) |
