|  Help  |  About  |  Contact Us

Allele : Tmem65<em1(IMPC)Tcp> transmembrane protein 65; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:6316224 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Tmem65
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from project TCPR1187 was generated at The Centre for Phenogenomics by injecting Cpf1 ribonucleoprotein complexes and single guide RNA(s) with spacer sequences of CCAGCATAACTCCTGTCAAGTAA targeting the 5' side and AGTAAAGAAATTAGTGTGCTCTA targeting the 3' side of a critical exon. This resulted in a 242-bp deletion Chr15:58794295 to 58794536 (GRCm38) resulting in a frameshift mutation in all annotated full length protein-coding transcripts.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

4 Publication categories