|  Help  |  About  |  Contact Us

Allele : Trh<em2(IMPC)Tcp> thyrotropin releasing hormone; endonuclease-mediated mutation 2, The Centre for Phenogenomics

Primary Identifier  MGI:6316227 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Trh
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from project TCPR0430 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of TCAAGAATCGACGTTCTGGC and GCTTTGATCTTCGTGCTAAC targeting the 5' side and CAGATGCCCCCCAAGTCAAG and GGATCTATGAACCTCCGGCC targeting the 3' side of the target region resulting in a 958-bp deletion of Chr6 from 92242876 to 92243833 with 1-bp insertion of A and a 4-bp deletion from 92242807 to 92242810 (GRCm38). This mutation is predicted to cause a frameshift with the amino acid changes after residue 16 and early truncation 24 amino acids later (p.L16Qfs*26).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories

Trail: Allele