| Primary Identifier | MGI:6316229 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Upf3b |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from project TCPR0565 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of GGAGATCACTTAGTTGGCCT and ATGGCATTTCTTCTACTATA targeting the 5' side and TTATTCACTGCGAACTAATA and TATATCCCCTGAGGCTGTCA targeting the 3' side of exons ENSMUSE00001311515 and ENSMUSE00001291484 resulting in a 2,466-bp deletion of ChrX from 37099869 to 37102334 (GRCm38). |
