|  Help  |  About  |  Contact Us

Allele : Fmnl2<em1(IMPC)Tcp> formin-like 2; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:6316180 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Fmnl2
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from project TCPR0254 was generated at The Centre for Phenogenomics by injecting Cas9 nickase (D10A) mRNA and two guide single RNAs with spacer sequences of TCCTCGATGGACCTGCTCCA and GGCAACAGTGTGTCCCGCTC resulting in a 28-bp deletion of Chr2:53054513-53054540 (GRCm38).
  • mutations:
  • Intragenic deletion,
  • Insertion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories