| Primary Identifier | MGI:6316180 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Fmnl2 |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from project TCPR0254 was generated at The Centre for Phenogenomics by injecting Cas9 nickase (D10A) mRNA and two guide single RNAs with spacer sequences of TCCTCGATGGACCTGCTCCA and GGCAACAGTGTGTCCCGCTC resulting in a 28-bp deletion of Chr2:53054513-53054540 (GRCm38). |
