| Primary Identifier | MGI:6316183 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Golph3 |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from project TCPR941 was generated at The Centre for Phenogenomics by injecting Cas9 ribonucleoprotein complexes and single guide RNA(s) with spacer sequences of TGGTACTTACCCAAGTCAAT and GGAAGGGTCGTCCTTTTACC targeting the 5' side and ACCGTTTACTCTGTTTAGAG and CGTTATGTTTTGTACACCAG targeting the 3' side leading to a 4,022-bp deletion from Chr15:12339468 to 12343489 (GRCm38) resulting in a frameshift mutation in all annotated full length protein-coding transcripts. |