|  Help  |  About  |  Contact Us

Allele : Exosc1<em1(IMPC)J> exosome component 1; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6316601 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Exosc1
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATTATGGATGTCACATACCA and GGACTTTAGCTCAGATTGAA, which resulted in a 3625 bp deletion beginning at Chromosome 19 position 41,924,589 bp and ending after 41,928,213 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000278630, ENSMUSE00000278546 (exons 4-7) and 3366 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 75 and early truncation 64 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Exosc1<->,
  • Exosc1<->
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

6 Publication categories