| Primary Identifier | MGI:6316601 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Exosc1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATTATGGATGTCACATACCA and GGACTTTAGCTCAGATTGAA, which resulted in a 3625 bp deletion beginning at Chromosome 19 position 41,924,589 bp and ending after 41,928,213 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000278630, ENSMUSE00000278546 (exons 4-7) and 3366 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 75 and early truncation 64 amino acids later. |