|  Help  |  About  |  Contact Us

Allele : A3galt2<em3(IMPC)H> alpha 1,3-galactosyltransferase 2; endonuclease-mediated mutation 3, Harwell

Primary Identifier  MGI:6341987 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  A3galt2
Strain of Origin  C57BL/6NTac Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from IMPC was generated at Medical Research Council Harwell by injecting CAS9 RNA and 4 guide sequences CCATAATGCCTCTGCCGAGGGAC, AGCCATAATGCCTCTGCCGAGGG, CCCAGCAAGAGGCGAGACGGCGG, GACGGCGGAACCTCACCATCGGG, which resulted in an intragenic deletion.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories