| Primary Identifier | MGI:6316629 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Ino80c |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTTATGTCTCTCTAGACAGA and CCCGCCTTACAGAAAATGGA, which resulted in a 2807 bp deletion beginning at Chromosome 18 position 24,111,655 bp and ending after 24,114,461 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001222154, ENSMUSE00000365673 (exon 2-4) and 2516 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 51 a deletion of 97 amino acids and then returns in frame for an additional 43 amino acid. |