| Primary Identifier | MGI:6316637 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Slc7a3 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GAACTCTGGGCCTTCACCAC and TGGCAGGCACTTCGAAGATT, which resulted in a 441 bp deletion beginning at Chromosome X position 101,083,784 bp and ending after 101,084,224 bp (GRCm38/mm10). This mutation deletes 354 bp of ENSMUSE00001284891 (exon 3) after the first 54 bp as well as 87 bp of flanking intronic sequence including the splice donor and is predicted to cause a change of amino acid sequence after residue 6 and early truncation 1 amino acid later. |
