|  Help  |  About  |  Contact Us

Allele : Ehbp1<em1(IMPC)J> EH domain binding protein 1; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6342439 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Ehbp1
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CCTGCGCCCATCCACTAAGA and GGCATAAATATTTATACTAG, which resulted in a 379 bp deletion beginning at Chromosome 11 position 22,172,810 bp and ending after 22,173,188 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001235276 (exon 6) and 197 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 104 and early truncation 1 amino acids later. There is a 6 bp deletion CTTAGG 4 bp after the 379 bp deletion.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

4 Publication categories